Tandem Repeats Finder Program written by:

                 Gary Benson
      Department of Biomathematical Sciences
          Mount Sinai School of Medicine

Version 3.01

Sequence:  Yeast Chromosome 1 - chri_230209

Parameters: 2 7 7 80 10 50 500

Pmatch=0.80,Pindel=0.10
tuple sizes 0,4,5,7
tuple distances 0, 29, 159, MAXDISTANCE

Length: 230209
ACGTcount: A:0.30, C:0.19, G:0.20, T:0.30


Found at i:10 original size:5 final size:5

Alignment explanation

Indices: 1--61 Score: 58 Period size: 5 Copynumber: 12.2 Consensus size: 5 1 CCACA CCACA CC-CA -CACA CC-CA -CACA CCACA CCACACA CCACA CCACA 1 CCACA CCACA CCACA CCACA CCACA CCACA CCACA -C-CACA CCACA CCACA 49 CCCACA CACACA C 1 -CCACA C-CACA C 62 ATCCTAACAC Statistics Matches: 48, Mismatches: 0, Indels: 15 0.76 0.00 0.24 Matches are distributed among these distances: 3 2 0.04 4 8 0.17 5 22 0.46 6 12 0.25 7 4 0.08 ACGTcount: A:0.39, C:0.61, G:0.00, T:0.00 Consensus pattern (5 bp): CCACA Found at i:19 original size:2 final size:2 Alignment explanation

Indices: 2--62 Score: 60 Period size: 2 Copynumber: 33.0 Consensus size: 2 1 C * * 2 CA CA C- CA CA CC CA CA CA CC CA CA CA C- CA CA C- CA CA CA C- 1 CA CA CA CA CA CA CA CA CA CA CA CA CA CA CA CA CA CA CA CA CA * 40 CA CA C- CA CA CC CA CA CA CA CA CA 1 CA CA CA CA CA CA CA CA CA CA CA CA 63 TCCTAACACT Statistics Matches: 48, Mismatches: 6, Indels: 10 0.75 0.09 0.16 Matches are distributed among these distances: 1 5 0.10 2 43 0.90 ACGTcount: A:0.41, C:0.59, G:0.00, T:0.00 Consensus pattern (2 bp): CA Found at i:11914 original size:27 final size:27 Alignment explanation

Indices: 11876--11935 Score: 102 Period size: 27 Copynumber: 2.2 Consensus size: 27 11866 TACTGTTTTC 11876 GTCTCAGCAGCTCCAGTACTGGTAGTT 1 GTCTCAGCAGCTCCAGTACTGGTAGTT * * 11903 GTCTCAGCAGCTCCAGTATTGGTTGTT 1 GTCTCAGCAGCTCCAGTACTGGTAGTT 11930 GTCTCA 1 GTCTCA 11936 CTGGTAGCAC Statistics Matches: 31, Mismatches: 2, Indels: 0 0.94 0.06 0.00 Matches are distributed among these distances: 27 31 1.00 ACGTcount: A:0.17, C:0.25, G:0.25, T:0.33 Consensus pattern (27 bp): GTCTCAGCAGCTCCAGTACTGGTAGTT Found at i:12545 original size:48 final size:48 Alignment explanation

Indices: 12474--12839 Score: 561 Period size: 48 Copynumber: 7.6 Consensus size: 48 12464 TCGCTCGTTT * * * * * * 12474 TTGTAGTGGTAGCAGGTGGTAATGAAGAAGCAGTTTCCTGGCTTGTTG 1 TTGTACTGGTAACAGGTGGTAATGATGAAGTAATTTCCTGACTTGTTG * * 12522 TTGTACTGATAACAGGTGGTAATGATGAAGTAATTTCCTGACTTGCTG 1 TTGTACTGGTAACAGGTGGTAATGATGAAGTAATTTCCTGACTTGTTG * * * 12570 TCGCACTGGTAACAGGTGGTAATGAAGAAGTAATTTCCTGACTTGTTG 1 TTGTACTGGTAACAGGTGGTAATGATGAAGTAATTTCCTGACTTGTTG 12618 TTGTACTGGTAACAGGTGGTAATGATGAAGTAATTTCCTGACTTGTTG 1 TTGTACTGGTAACAGGTGGTAATGATGAAGTAATTTCCTGACTTGTTG * 12666 TTGTACTGGTAACAGGTGGTAATGAAGAAGTAATTTCCTGACTTGTTG 1 TTGTACTGGTAACAGGTGGTAATGATGAAGTAATTTCCTGACTTGTTG * 12714 TTGCACTGGTAACAGGTGGTAATGATGAAGTAATTTCCTGACTTGTTG 1 TTGTACTGGTAACAGGTGGTAATGATGAAGTAATTTCCTGACTTGTTG * * * 12762 TTGTACTGGTAACAGGTGGTAATGATGAAGCAGTTTCCTGGCTTGTTG 1 TTGTACTGGTAACAGGTGGTAATGATGAAGTAATTTCCTGACTTGTTG * * * 12810 TTGCAGTGGTAATAGGTGGTAATGATGAAG 1 TTGTACTGGTAACAGGTGGTAATGATGAAG 12840 ACGAATATGT Statistics Matches: 292, Mismatches: 26, Indels: 0 0.92 0.08 0.00 Matches are distributed among these distances: 48 292 1.00 ACGTcount: A:0.25, C:0.11, G:0.29, T:0.34 Consensus pattern (48 bp): TTGTACTGGTAACAGGTGGTAATGATGAAGTAATTTCCTGACTTGTTG Found at i:13065 original size:45 final size:45 Alignment explanation

Indices: 13000--13113 Score: 140 Period size: 45 Copynumber: 2.5 Consensus size: 45 12990 AGGTTGTTGT * * * * 13000 AGAAGAAATGACAGGGGAAGAAATGAATGAAGAAGAAATGACTGG 1 AGAAGAAGTGACTGAGGAAGAAATGAATGAAGAAGAAATGACTAG * * * 13045 AGAAGAAGTGACT-AGAGAAGAAGTGACTGAGGAAGAAATGACTAG 1 AGAAGAAGTGACTGAG-GAAGAAATGAATGAAGAAGAAATGACTAG * 13090 AGAAGAAGTGTCTGAGGAAGAAAT 1 AGAAGAAGTGACTGAGGAAGAAAT 13114 TACTGAGGAG Statistics Matches: 58, Mismatches: 9, Indels: 4 0.82 0.13 0.06 Matches are distributed among these distances: 44 1 0.02 45 55 0.95 46 2 0.03 ACGTcount: A:0.48, C:0.05, G:0.33, T:0.13 Consensus pattern (45 bp): AGAAGAAGTGACTGAGGAAGAAATGAATGAAGAAGAAATGACTAG Found at i:13119 original size:15 final size:15 Alignment explanation

Indices: 13001--13128 Score: 118 Period size: 15 Copynumber: 8.5 Consensus size: 15 12991 GGTTGTTGTA * * 13001 GAAGAAATGACAGGG 1 GAAGAAATGACTGAG * * 13016 GAAGAAATGAATGAA 1 GAAGAAATGACTGAG 13031 GAAGAAATGACTG-G 1 GAAGAAATGACTGAG * 13045 AGAAGAAGTGACT-AG 1 -GAAGAAATGACTGAG * 13060 AGAAGAAGTGACTGAG 1 -GAAGAAATGACTGAG 13076 GAAGAAATGACT-AG 1 GAAGAAATGACTGAG * * 13090 AGAAGAAGTGTCTGAG 1 -GAAGAAATGACTGAG * 13106 GAAGAAATTACTGAG 1 GAAGAAATGACTGAG * 13121 GAGGAAAT 1 GAAGAAAT 13129 CACAGAAGTT Statistics Matches: 94, Mismatches: 14, Indels: 10 0.80 0.12 0.08 Matches are distributed among these distances: 14 2 0.02 15 88 0.94 16 4 0.04 ACGTcount: A:0.47, C:0.05, G:0.34, T:0.14 Consensus pattern (15 bp): GAAGAAATGACTGAG Found at i:14809 original size:13 final size:13 Alignment explanation

Indices: 14791--14821 Score: 53 Period size: 13 Copynumber: 2.4 Consensus size: 13 14781 AAAAGGAAGG 14791 AAAAATAGATGTC 1 AAAAATAGATGTC * 14804 AAAAATCGATGTC 1 AAAAATAGATGTC 14817 AAAAA 1 AAAAA 14822 ATCTCGTGAG Statistics Matches: 17, Mismatches: 1, Indels: 0 0.94 0.06 0.00 Matches are distributed among these distances: 13 17 1.00 ACGTcount: A:0.58, C:0.10, G:0.13, T:0.19 Consensus pattern (13 bp): AAAAATAGATGTC Found at i:24346 original size:27 final size:27 Alignment explanation

Indices: 24308--24367 Score: 102 Period size: 27 Copynumber: 2.2 Consensus size: 27 24298 TACTGTTTTC 24308 GTCTCAGCAGCTCCAGTACTGGTAGTT 1 GTCTCAGCAGCTCCAGTACTGGTAGTT * * 24335 GTCTCAGCAGCTCCAGTATTGGTTGTT 1 GTCTCAGCAGCTCCAGTACTGGTAGTT 24362 GTCTCA 1 GTCTCA 24368 CTGGTAGCAC Statistics Matches: 31, Mismatches: 2, Indels: 0 0.94 0.06 0.00 Matches are distributed among these distances: 27 31 1.00 ACGTcount: A:0.17, C:0.25, G:0.25, T:0.33 Consensus pattern (27 bp): GTCTCAGCAGCTCCAGTACTGGTAGTT Found at i:24714 original size:21 final size:21 Alignment explanation

Indices: 24690--24780 Score: 103 Period size: 21 Copynumber: 4.3 Consensus size: 21 24680 ATTGTAACTA * * 24690 CTGTGGTTTGTTTTGTTGTTT 1 CTGTGGTTTGCTTTGTTGTCT * * 24711 CTGTGGTTTGCTCTGTTGTCCC 1 CTGTGGTTTGCTTTGTTGT-CT 24733 CT-TGGTTTGCTTTGTTGTCT 1 CTGTGGTTTGCTTTGTTGTCT * * * 24753 CCGTAGTTTGCTTTGTTATCT 1 CTGTGGTTTGCTTTGTTGTCT 24774 CTGTGGT 1 CTGTGGT 24781 AGAAATAGGG Statistics Matches: 57, Mismatches: 11, Indels: 4 0.79 0.15 0.06 Matches are distributed among these distances: 20 2 0.04 21 53 0.93 22 2 0.04 ACGTcount: A:0.02, C:0.16, G:0.26, T:0.55 Consensus pattern (21 bp): CTGTGGTTTGCTTTGTTGTCT Found at i:25230 original size:45 final size:45 Alignment explanation

Indices: 25165--25278 Score: 140 Period size: 45 Copynumber: 2.5 Consensus size: 45 25155 AGGTTGTTGT * * * * 25165 AGAAGAAATGACAGGGGAAGAAATGAATGAAGAAGAAATGACTGG 1 AGAAGAAGTGACTGAGGAAGAAATGAATGAAGAAGAAATGACTAG * * * 25210 AGAAGAAGTGACT-AGAGAAGAAGTGACTGAGGAAGAAATGACTAG 1 AGAAGAAGTGACTGAG-GAAGAAATGAATGAAGAAGAAATGACTAG * 25255 AGAAGAAGTGTCTGAGGAAGAAAT 1 AGAAGAAGTGACTGAGGAAGAAAT 25279 TACTGAGGAG Statistics Matches: 58, Mismatches: 9, Indels: 4 0.82 0.13 0.06 Matches are distributed among these distances: 44 1 0.02 45 55 0.95 46 2 0.03 ACGTcount: A:0.48, C:0.05, G:0.33, T:0.13 Consensus pattern (45 bp): AGAAGAAGTGACTGAGGAAGAAATGAATGAAGAAGAAATGACTAG Found at i:25284 original size:15 final size:15 Alignment explanation

Indices: 25166--25293 Score: 118 Period size: 15 Copynumber: 8.5 Consensus size: 15 25156 GGTTGTTGTA * * 25166 GAAGAAATGACAGGG 1 GAAGAAATGACTGAG * * 25181 GAAGAAATGAATGAA 1 GAAGAAATGACTGAG 25196 GAAGAAATGACTG-G 1 GAAGAAATGACTGAG * 25210 AGAAGAAGTGACT-AG 1 -GAAGAAATGACTGAG * 25225 AGAAGAAGTGACTGAG 1 -GAAGAAATGACTGAG 25241 GAAGAAATGACT-AG 1 GAAGAAATGACTGAG * * 25255 AGAAGAAGTGTCTGAG 1 -GAAGAAATGACTGAG * 25271 GAAGAAATTACTGAG 1 GAAGAAATGACTGAG * 25286 GAGGAAAT 1 GAAGAAAT 25294 CACAGAAGTT Statistics Matches: 94, Mismatches: 14, Indels: 10 0.80 0.12 0.08 Matches are distributed among these distances: 14 2 0.02 15 88 0.94 16 4 0.04 ACGTcount: A:0.47, C:0.05, G:0.34, T:0.14 Consensus pattern (15 bp): GAAGAAATGACTGAG Found at i:25667 original size:135 final size:135 Alignment explanation

Indices: 25401--26304 Score: 503 Period size: 135 Copynumber: 6.7 Consensus size: 135 25391 GAGATGGCAG * * * * * * * * 25401 TAGTTGGAGTTTTGACAATAATGACAGTTTCATCAGTTGGTTGACCGTTGGTTCCAGTGATGGTG 1 TAGTTGGAGTTCTGATAACAATGACGGTTTCGTCAGTTGGTTGACCGTTGGTACCGGTGACGGTG * * * * * 25466 GTCATCTCAGTAGATGTAGAGGTGAAAGTACCGGTCCATGGCTCGGTTGTAGTTGTAACCAAACC 66 GTCATCTCAGTGGATGTAGAGGTGAAAGTACCAGTCCATGGCTCAGTGGTAGGTGTAACCAAACC 25531 TTCAC 131 TTCAC * * * 25536 TGGTTGGAGTTCTGATAACAATCACGGTTTCGTCAGTTGGTTGACCGTTAGTACCGGTGACGGTG 1 TAGTTGGAGTTCTGATAACAATGACGGTTTCGTCAGTTGGTTGACCGTTGGTACCGGTGACGGTG * * ** * 25601 GTCATCTCAGTGGATGTAGAGGTGAAAGTACCAGTCCATGGTTCAGTGGT-GGTGCTGATTAGAC 66 GTCATCTCAGTGGATGTAGAGGTGAAAGTACCAGTCCATGGCTCAGTGGTAGGTG-TAACCAAAC 25665 CTTCAC 130 CTTCAC * ** 25671 TAGTTGGAGTTCTGATGACAATGACGGTTTCGTCAGTTGGAACG-CCGTTGGTACCGGTGACGGT 1 TAGTTGGAGTTCTGATAACAATGACGGTTTCGTCAGTTGG-TTGACCGTTGGTACCGGTGACGGT * * ** * * * ** 25735 GGTCATTTCAGTGGATGTAGAGGTAAAAGTGTC-GTTCCATGGCTGAGTTGTA-GT-CATGGCAG 65 GGTCATCTCAGTGGATGTAGAGGTGAAAGTACCAG-TCCATGGCTCAGTGGTAGGTGTA-ACCA- * * * ** 25797 TA-GTGGCTG 127 AACCT-TCAC * * * * * * *** 25806 TTGTTGGTGTTCTGATGACAATGATGGTCTCATCAGTTGGCAAACCGTTGGTACCGGTGACGGTG 1 TAGTTGGAGTTCTGATAACAATGACGGTTTCGTCAGTTGGTTGACCGTTGGTACCGGTGACGGTG * * * ** * * * ** * 25871 GTGATTTCAGTGGATGTAGAGGTAAAAGTGTC-GTTCCATGGCTGAGTTGTA-GT-CATGGCAGT 66 GTCATCTCAGTGGATGTAGAGGTGAAAGTACCAG-TCCATGGCTCAGTGGTAGGTGTA-ACCA-A * * ** 25933 A-GTGGCTG 128 ACCT-TCAC * * * * * *** 25941 TTGTTGGTGTTCTGATGACAATGATGGTTTCATCAGTTGGCAAACCGTTGGTACCGGTGACGGTG 1 TAGTTGGAGTTCTGATAACAATGACGGTTTCGTCAGTTGGTTGACCGTTGGTACCGGTGACGGTG * * ** * * ** * 26006 GTCATTTCAGTGGATGTAGAGGTAAAAGTGTC-GTTCCATGGCTGAGTTGTA-GT-TATGGCAGT 66 GTCATCTCAGTGGATGTAGAGGTGAAAGTACCAG-TCCATGGCTCAGTGGTAGGTGTA-ACCA-A * * ** 26068 A-GTGGCTG 128 ACCT-TCAC * * * * * *** 26076 TTGTTGGTGTTCTGATGACAATGATGGTTTCATCAGTTGGCAAACCGTTGGTACCGGTGACGGTG 1 TAGTTGGAGTTCTGATAACAATGACGGTTTCGTCAGTTGGTTGACCGTTGGTACCGGTGACGGTG * * * * * ** * 26141 GTCATTTCAGTGGATGTAGAGGTAAAAGT-GCTGTTCCATGGCTCAGTTGTA-GT-TATGGCAGT 66 GTCATCTCAGTGGATGTAGAGGTGAAAGTACCAG-TCCATGGCTCAGTGGTAGGTGTA-ACCA-A * * ** 26203 A-GTGGCTG 128 ACCT-TCAC * * * * * *** 26211 TTGTTGGTGTTCTGATGACAATGATGGTTTCATCAGTTGGCAAACCGTTGGTACCGGTGACGGTG 1 TAGTTGGAGTTCTGATAACAATGACGGTTTCGTCAGTTGGTTGACCGTTGGTACCGGTGACGGTG * * 26276 GTCATTTCAGTGGATGTAGAGGTAAAAGT 66 GTCATCTCAGTGGATGTAGAGGTGAAAGT 26305 GTCGTTCCAT Statistics Matches: 702, Mismatches: 58, Indels: 18 0.90 0.07 0.02 Matches are distributed among these distances: 134 7 0.01 135 694 0.99 136 1 0.00 ACGTcount: A:0.21, C:0.15, G:0.32, T:0.32 Consensus pattern (135 bp): TAGTTGGAGTTCTGATAACAATGACGGTTTCGTCAGTTGGTTGACCGTTGGTACCGGTGACGGTG GTCATCTCAGTGGATGTAGAGGTGAAAGTACCAGTCCATGGCTCAGTGGTAGGTGTAACCAAACC TTCAC Found at i:26334 original size:135 final size:135 Alignment explanation

Indices: 25673--27105 Score: 2230 Period size: 135 Copynumber: 10.6 Consensus size: 135 25663 ACCTTCACTA * * * * 25673 GTTGGAGTTCTGATGACAATGACGGTTTCGTCAGTTGG-AACGCCGTTGGTACCGGTGACGGTGG 1 GTTGGTGTTCTGATGACAATGATGGTTTCATCAGTTGGCAA-ACCGTTGGTACCGGTGACGGTGG 25737 TCATTTCAGTGGATGTAGAGGTAAAAGTGTCGTTCCATGGCTGAGTTGTAGTCATGGCAGTAGTG 65 TCATTTCAGTGGATGTAGAGGTAAAAGTGTCGTTCCATGGCTGAGTTGTAGTCATGGCAGTAGTG 25802 GCTGTT 130 GCTGTT * 25808 GTTGGTGTTCTGATGACAATGATGGTCTCATCAGTTGGCAAACCGTTGGTACCGGTGACGGTGGT 1 GTTGGTGTTCTGATGACAATGATGGTTTCATCAGTTGGCAAACCGTTGGTACCGGTGACGGTGGT * 25873 GATTTCAGTGGATGTAGAGGTAAAAGTGTCGTTCCATGGCTGAGTTGTAGTCATGGCAGTAGTGG 66 CATTTCAGTGGATGTAGAGGTAAAAGTGTCGTTCCATGGCTGAGTTGTAGTCATGGCAGTAGTGG 25938 CTGTT 131 CTGTT 25943 GTTGGTGTTCTGATGACAATGATGGTTTCATCAGTTGGCAAACCGTTGGTACCGGTGACGGTGGT 1 GTTGGTGTTCTGATGACAATGATGGTTTCATCAGTTGGCAAACCGTTGGTACCGGTGACGGTGGT * 26008 CATTTCAGTGGATGTAGAGGTAAAAGTGTCGTTCCATGGCTGAGTTGTAGTTATGGCAGTAGTGG 66 CATTTCAGTGGATGTAGAGGTAAAAGTGTCGTTCCATGGCTGAGTTGTAGTCATGGCAGTAGTGG 26073 CTGTT 131 CTGTT 26078 GTTGGTGTTCTGATGACAATGATGGTTTCATCAGTTGGCAAACCGTTGGTACCGGTGACGGTGGT 1 GTTGGTGTTCTGATGACAATGATGGTTTCATCAGTTGGCAAACCGTTGGTACCGGTGACGGTGGT * * 26143 CATTTCAGTGGATGTAGAGGTAAAAGTG-CTGTTCCATGGCTCAGTTGTAGTTATGGCAGTAGTG 66 CATTTCAGTGGATGTAGAGGTAAAAGTGTC-GTTCCATGGCTGAGTTGTAGTCATGGCAGTAGTG 26207 GCTGTT 130 GCTGTT 26213 GTTGGTGTTCTGATGACAATGATGGTTTCATCAGTTGGCAAACCGTTGGTACCGGTGACGGTGGT 1 GTTGGTGTTCTGATGACAATGATGGTTTCATCAGTTGGCAAACCGTTGGTACCGGTGACGGTGGT 26278 CATTTCAGTGGATGTAGAGGTAAAAGTGTCGTTCCATGGCTGAGTTGTAGTCATGGCAGTAGTGG 66 CATTTCAGTGGATGTAGAGGTAAAAGTGTCGTTCCATGGCTGAGTTGTAGTCATGGCAGTAGTGG 26343 CTGTT 131 CTGTT * * 26348 GTTGGTGTTCTGATGACAATGATGGTCTCATCAGTTGGCAAACCATTGGTACCGGTGACGGTGGT 1 GTTGGTGTTCTGATGACAATGATGGTTTCATCAGTTGGCAAACCGTTGGTACCGGTGACGGTGGT * 26413 GATTTCAGTGGATGTAGAGGTAAAAGTGTCGTTCCATGGCTGAGTTGTAGTCATGGCAGTAGTGG 66 CATTTCAGTGGATGTAGAGGTAAAAGTGTCGTTCCATGGCTGAGTTGTAGTCATGGCAGTAGTGG 26478 CTGTT 131 CTGTT * * * 26483 GTTGGTGTTCTGATGACAATGATGGTCTCATCAGTTGGCAAACCATTGGTACCGGTGACTGTGGT 1 GTTGGTGTTCTGATGACAATGATGGTTTCATCAGTTGGCAAACCGTTGGTACCGGTGACGGTGGT * * * * 26548 CAATTCGGTAGAAGTAGAGGTAAAAGTGTCGTTCCATGGCTGAGTTGTAGTCATGGCAGTAGTGG 66 CATTTCAGTGGATGTAGAGGTAAAAGTGTCGTTCCATGGCTGAGTTGTAGTCATGGCAGTAGTGG 26613 CTGTT 131 CTGTT * * * 26618 GTTGGTGTTCTGATGACAATGATGGTCTCATCAGTTGGCAAACCATTGGTACCGGTGACTGTGGT 1 GTTGGTGTTCTGATGACAATGATGGTTTCATCAGTTGGCAAACCGTTGGTACCGGTGACGGTGGT * * * * 26683 CAATTCGGTAGAAGTAGAGGTAAAAGTGTCGTTCCATGGCTGAGTTGTAGTCATGGCAGTAGTGG 66 CATTTCAGTGGATGTAGAGGTAAAAGTGTCGTTCCATGGCTGAGTTGTAGTCATGGCAGTAGTGG 26748 CTGTT 131 CTGTT * * * 26753 GTTGGTGTTCTGATGACAATGATGGTCTCATCAGTTGGCAAACCATTGGTACCGGTGACTGTGGT 1 GTTGGTGTTCTGATGACAATGATGGTTTCATCAGTTGGCAAACCGTTGGTACCGGTGACGGTGGT * * * * * * 26818 CAATTCGGTAGAAGTAGAGGTAAAAGTG-CTGTTCCATGGCTCAGTTGTAGTTATGGCAGTAGTG 66 CATTTCAGTGGATGTAGAGGTAAAAGTGTC-GTTCCATGGCTGAGTTGTAGTCATGGCAGTAGTG 26882 GCTGTT 130 GCTGTT * * * * * * * * * 26888 GTTGGTGTTCTGATTACAATGATGGTTTCGTCAGTTCGTACACCATTGGTGCCAGTGACTGTGGT 1 GTTGGTGTTCTGATGACAATGATGGTTTCATCAGTTGGCAAACCGTTGGTACCGGTGACGGTGGT * * * * * * *** 26953 CAATTCGGTAGAAGTAGAGGTAAAAGTG-CTGTTCCATGGCTCAGTTGTAGTTATGATGGT-GCT 66 CATTTCAGTGGATGTAGAGGTAAAAGTGTC-GTTCCATGGCTGAGTTGTAGTCATGGCAGTAG-T * * 27016 AGCAGTT 129 GGCTGTT * * * * 27023 GTTGGAGTTCTGATGACAATGACGGTTTCGTCAGTTGG-AACGCCGTTGGTACCGGTGACGGTGG 1 GTTGGTGTTCTGATGACAATGATGGTTTCATCAGTTGGCAA-ACCGTTGGTACCGGTGACGGTGG * 27087 TCATTTCAGTAGATGTAGA 65 TCATTTCAGTGGATGTAGA 27106 AGTGAAAGTA Statistics Matches: 1243, Mismatches: 49, Indels: 12 0.95 0.04 0.01 Matches are distributed among these distances: 134 4 0.00 135 1236 0.99 136 3 0.00 ACGTcount: A:0.21, C:0.14, G:0.33, T:0.32 Consensus pattern (135 bp): GTTGGTGTTCTGATGACAATGATGGTTTCATCAGTTGGCAAACCGTTGGTACCGGTGACGGTGGT CATTTCAGTGGATGTAGAGGTAAAAGTGTCGTTCCATGGCTGAGTTGTAGTCATGGCAGTAGTGG CTGTT Found at i:31136 original size:2 final size:2 Alignment explanation

Indices: 31123--31152 Score: 51 Period size: 2 Copynumber: 15.0 Consensus size: 2 31113 CATAGGAGGC * 31123 AT AT AC AT AT AT AT AT AT AT AT AT AT AT AT 1 AT AT AT AT AT AT AT AT AT AT AT AT AT AT AT 31153 GGCTGCTGAC Statistics Matches: 26, Mismatches: 2, Indels: 0 0.93 0.07 0.00 Matches are distributed among these distances: 2 26 1.00 ACGTcount: A:0.50, C:0.03, G:0.00, T:0.47 Consensus pattern (2 bp): AT Found at i:76856 original size:15 final size:15 Alignment explanation

Indices: 76836--76864 Score: 58 Period size: 15 Copynumber: 1.9 Consensus size: 15 76826 TGTTGAAAAA 76836 GCTGCTGCTGAGAAG 1 GCTGCTGCTGAGAAG 76851 GCTGCTGCTGAGAA 1 GCTGCTGCTGAGAA 76865 ATCCCAAAAA Statistics Matches: 14, Mismatches: 0, Indels: 0 1.00 0.00 0.00 Matches are distributed among these distances: 15 14 1.00 ACGTcount: A:0.21, C:0.21, G:0.38, T:0.21 Consensus pattern (15 bp): GCTGCTGCTGAGAAG Found at i:77025 original size:24 final size:24 Alignment explanation

Indices: 76983--77049 Score: 66 Period size: 24 Copynumber: 2.8 Consensus size: 24 76973 GAAACAACTT * 76983 GAAGAACAAGAAA-AGTTGGA-AAGA 1 GAAGAAGAAGAAAGA-TTGGAGAA-A * 77007 GAGGAAGAAGAAAGATTGGAGAAA 1 GAAGAAGAAGAAAGATTGGAGAAA * * 77031 GAAGAGGAGGAAAGATTGG 1 GAAGAAGAAGAAAGATTGG 77050 CCAACGAAGA Statistics Matches: 36, Mismatches: 5, Indels: 4 0.80 0.11 0.09 Matches are distributed among these distances: 24 33 0.92 25 3 0.08 ACGTcount: A:0.52, C:0.01, G:0.37, T:0.09 Consensus pattern (24 bp): GAAGAAGAAGAAAGATTGGAGAAA Found at i:77510 original size:3 final size:3 Alignment explanation

Indices: 77502--77546 Score: 81 Period size: 3 Copynumber: 15.0 Consensus size: 3 77492 AAATCAAGGC * 77502 GAA GAA GAA GAA GAA GGA GAA GAA GAA GAA GAA GAA GAA GAA GAA 1 GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA GAA 77547 AGAGCACATG Statistics Matches: 40, Mismatches: 2, Indels: 0 0.95 0.05 0.00 Matches are distributed among these distances: 3 40 1.00 ACGTcount: A:0.64, C:0.00, G:0.36, T:0.00 Consensus pattern (3 bp): GAA Found at i:77594 original size:12 final size:12 Alignment explanation

Indices: 77577--77602 Score: 52 Period size: 12 Copynumber: 2.2 Consensus size: 12 77567 TGCCAAAAGC 77577 ACACCAGCAGCT 1 ACACCAGCAGCT 77589 ACACCAGCAGCT 1 ACACCAGCAGCT 77601 AC 1 AC 77603 TCCAACTCCA Statistics Matches: 14, Mismatches: 0, Indels: 0 1.00 0.00 0.00 Matches are distributed among these distances: 12 14 1.00 ACGTcount: A:0.35, C:0.42, G:0.15, T:0.08 Consensus pattern (12 bp): ACACCAGCAGCT Found at i:99964 original size:14 final size:14 Alignment explanation

Indices: 99945--99976 Score: 64 Period size: 14 Copynumber: 2.3 Consensus size: 14 99935 AATAATCCCG 99945 TAATAGTAAGCTTC 1 TAATAGTAAGCTTC 99959 TAATAGTAAGCTTC 1 TAATAGTAAGCTTC 99973 TAAT 1 TAAT 99977 TTGCAATGTT Statistics Matches: 18, Mismatches: 0, Indels: 0 1.00 0.00 0.00 Matches are distributed among these distances: 14 18 1.00 ACGTcount: A:0.38, C:0.13, G:0.13, T:0.38 Consensus pattern (14 bp): TAATAGTAAGCTTC Found at i:100394 original size:18 final size:18 Alignment explanation

Indices: 100371--100414 Score: 61 Period size: 18 Copynumber: 2.4 Consensus size: 18 100361 ATCACTATCG 100371 CTGTCGCTCTCGCTTTCA 1 CTGTCGCTCTCGCTTTCA * * 100389 CTGTCGCTTTCGCTTTGA 1 CTGTCGCTCTCGCTTTCA * 100407 CTGGCGCT 1 CTGTCGCT 100415 GGAAGCTTCT Statistics Matches: 23, Mismatches: 3, Indels: 0 0.88 0.12 0.00 Matches are distributed among these distances: 18 23 1.00 ACGTcount: A:0.05, C:0.34, G:0.23, T:0.39 Consensus pattern (18 bp): CTGTCGCTCTCGCTTTCA Found at i:100495 original size:27 final size:27 Alignment explanation

Indices: 100465--100516 Score: 86 Period size: 27 Copynumber: 1.9 Consensus size: 27 100455 TCATCCACGT * * 100465 CAACGTATTCACCTTCGCCATCATCTG 1 CAACGTATTCAACTTCCCCATCATCTG 100492 CAACGTATTCAACTTCCCCATCATC 1 CAACGTATTCAACTTCCCCATCATC 100517 ACTTTCCTCT Statistics Matches: 23, Mismatches: 2, Indels: 0 0.92 0.08 0.00 Matches are distributed among these distances: 27 23 1.00 ACGTcount: A:0.25, C:0.38, G:0.08, T:0.29 Consensus pattern (27 bp): CAACGTATTCAACTTCCCCATCATCTG Found at i:101499 original size:15 final size:15 Alignment explanation

Indices: 101479--101511 Score: 57 Period size: 15 Copynumber: 2.2 Consensus size: 15 101469 AACATGTATG 101479 TATGCTCCATCTATA 1 TATGCTCCATCTATA * 101494 TATGCTCCATCTGTA 1 TATGCTCCATCTATA 101509 TAT 1 TAT 101512 TTTATATGCA Statistics Matches: 17, Mismatches: 1, Indels: 0 0.94 0.06 0.00 Matches are distributed among these distances: 15 17 1.00 ACGTcount: A:0.24, C:0.24, G:0.09, T:0.42 Consensus pattern (15 bp): TATGCTCCATCTATA Found at i:113063 original size:3 final size:3 Alignment explanation

Indices: 113055--113099 Score: 72 Period size: 3 Copynumber: 15.0 Consensus size: 3 113045 TTCCACCGCC * * 113055 GTT GTT GTT GTT GTT GTT GTT GTT GTT ATT GTT GTT ATT GTT GTT 1 GTT GTT GTT GTT GTT GTT GTT GTT GTT GTT GTT GTT GTT GTT GTT 113100 ATCCATGTTC Statistics Matches: 38, Mismatches: 4, Indels: 0 0.90 0.10 0.00 Matches are distributed among these distances: 3 38 1.00 ACGTcount: A:0.04, C:0.00, G:0.29, T:0.67 Consensus pattern (3 bp): GTT Found at i:116506 original size:9 final size:9 Alignment explanation

Indices: 116484--116520 Score: 56 Period size: 9 Copynumber: 4.1 Consensus size: 9 116474 GATGTGGAAT * 116484 ATGATGATG 1 ATGACGATG * 116493 GTGACGATG 1 ATGACGATG 116502 ATGACGATG 1 ATGACGATG 116511 ATGACGATG 1 ATGACGATG 116520 A 1 A 116521 ATTTGTCGCT Statistics Matches: 25, Mismatches: 3, Indels: 0 0.89 0.11 0.00 Matches are distributed among these distances: 9 25 1.00 ACGTcount: A:0.32, C:0.08, G:0.35, T:0.24 Consensus pattern (9 bp): ATGACGATG Found at i:120173 original size:5 final size:5 Alignment explanation

Indices: 120163--120189 Score: 54 Period size: 5 Copynumber: 5.4 Consensus size: 5 120153 TTTCTTCTAT 120163 TTTTG TTTTG TTTTG TTTTG TTTTG TT 1 TTTTG TTTTG TTTTG TTTTG TTTTG TT 120190 CTCTCCCTAA Statistics Matches: 22, Mismatches: 0, Indels: 0 1.00 0.00 0.00 Matches are distributed among these distances: 5 22 1.00 ACGTcount: A:0.00, C:0.00, G:0.19, T:0.81 Consensus pattern (5 bp): TTTTG Found at i:124943 original size:9 final size:9 Alignment explanation

Indices: 124929--124958 Score: 51 Period size: 9 Copynumber: 3.3 Consensus size: 9 124919 CCCTCGGCAG 124929 CAACAACAT 1 CAACAACAT 124938 CAACAACAT 1 CAACAACAT * 124947 CAACAACGT 1 CAACAACAT 124956 CAA 1 CAA 124959 ACTCTAAGGA Statistics Matches: 20, Mismatches: 1, Indels: 0 0.95 0.05 0.00 Matches are distributed among these distances: 9 20 1.00 ACGTcount: A:0.53, C:0.33, G:0.03, T:0.10 Consensus pattern (9 bp): CAACAACAT Found at i:139588 original size:12 final size:12 Alignment explanation

Indices: 139552--139610 Score: 66 Period size: 12 Copynumber: 4.9 Consensus size: 12 139542 TGGAGCTGGA 139552 GGAGCACCACCT 1 GGAGCACCACCT * * 139564 GG-GAAACCGCCT 1 GGAG-CACCACCT 139576 GGAGCACCACCT 1 GGAGCACCACCT * * 139588 GCAGCGCCACCT 1 GGAGCACCACCT 139600 GGAGCACCACC 1 GGAGCACCACC 139611 AGCTTGGTAC Statistics Matches: 37, Mismatches: 8, Indels: 4 0.76 0.16 0.08 Matches are distributed among these distances: 11 1 0.03 12 35 0.95 13 1 0.03 ACGTcount: A:0.24, C:0.42, G:0.27, T:0.07 Consensus pattern (12 bp): GGAGCACCACCT Found at i:190150 original size:14 final size:14 Alignment explanation

Indices: 190131--190161 Score: 62 Period size: 14 Copynumber: 2.2 Consensus size: 14 190121 GAAGCACACC 190131 CACGACAATAACCA 1 CACGACAATAACCA 190145 CACGACAATAACCA 1 CACGACAATAACCA 190159 CAC 1 CAC 190162 CCGCCCACCC Statistics Matches: 17, Mismatches: 0, Indels: 0 1.00 0.00 0.00 Matches are distributed among these distances: 14 17 1.00 ACGTcount: A:0.48, C:0.39, G:0.06, T:0.06 Consensus pattern (14 bp): CACGACAATAACCA Found at i:192293 original size:3 final size:3 Alignment explanation

Indices: 192287--192322 Score: 63 Period size: 3 Copynumber: 11.7 Consensus size: 3 192277 ATATTATTTT 192287 TAC TAC TAC TAC TAC TAC TAC TAC TAC TAC ATAC TA 1 TAC TAC TAC TAC TAC TAC TAC TAC TAC TAC -TAC TA 192323 TTAAATATAC Statistics Matches: 32, Mismatches: 0, Indels: 2 0.94 0.00 0.06 Matches are distributed among these distances: 3 29 0.91 4 3 0.09 ACGTcount: A:0.36, C:0.31, G:0.00, T:0.33 Consensus pattern (3 bp): TAC Found at i:198849 original size:11 final size:11 Alignment explanation

Indices: 198835--198864 Score: 51 Period size: 11 Copynumber: 2.7 Consensus size: 11 198825 CTCTTCACTT 198835 TTTCTTCGTGG 1 TTTCTTCGTGG 198846 TTTCTTCGTGG 1 TTTCTTCGTGG * 198857 TTTTTTCG 1 TTTCTTCG 198865 AGAGTTTTGT Statistics Matches: 18, Mismatches: 1, Indels: 0 0.95 0.05 0.00 Matches are distributed among these distances: 11 18 1.00 ACGTcount: A:0.00, C:0.17, G:0.23, T:0.60 Consensus pattern (11 bp): TTTCTTCGTGG Found at i:204466 original size:135 final size:135 Alignment explanation

Indices: 204258--205690 Score: 2212 Period size: 135 Copynumber: 10.6 Consensus size: 135 204248 TACTTTCACT * * * * 204258 TCTACATCTACTGAAATGACCACCGTCACCGGTACCAACGGCGTT-CCAACTGACGAAACCGTCA 1 TCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGG-TTTGCCAACTGATGAAACCATCA * * * *** * * 204322 TTGTCATCAGAACTCCAACAACTGCTAGC-ACCATCATAACTACAACTGAGCCATGGAAC-AGCA 65 TTGTCATCAGAACACCAACAACAGCCA-CTACTGCCATGACTACAACTCAGCCATGGAACGA-CA 204385 CTTTTACC 128 CTTTTACC * * * * * * * * * * * * 204393 TCTACTTCTACCGAATTGACCACAGTCACTGGCACCAATGGTGTACGAACTGACGAAACCATCAT 1 TCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTGCCAACTGATGAAACCATCAT * * * 204458 TGTAATCAGAACACCAACAACAGCCACTACTGCCATAACTACAACTGAGCCATGGAAC-AGCACT 66 TGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCCATGGAACGA-CACT 204522 TTTACC 130 TTTACC * * * * * * * 204528 TCTACTTCTACCGAATTGACCACAGTCACCGGTACCAATGGTTTGCCAACTGATGAGACCATCAT 1 TCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTGCCAACTGATGAAACCATCAT 204593 TGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCCATGGAACGACACTT 66 TGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCCATGGAACGACACTT 204658 TTACC 131 TTACC * * * * * * * 204663 TCTACTTCTACCGAATTGACCACAGTCACCGGTACCAATGGTTTGCCAACTGATGAGACCATCAT 1 TCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTGCCAACTGATGAAACCATCAT 204728 TGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCCATGGAACGACACTT 66 TGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCCATGGAACGACACTT 204793 TTACC 131 TTACC * * * * * * * 204798 TCTACTTCTACCGAATTGACCACAGTCACCGGTACCAATGGTTTGCCAACTGATGAGACCATCAT 1 TCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTGCCAACTGATGAAACCATCAT 204863 TGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCCATGGAACGACACTT 66 TGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCCATGGAACGACACTT 204928 TTACC 131 TTACC * * * 204933 TCTACATCCACTGAAATCACCACCGTCACCGGTACCAATGGTTTGCCAACTGATGAGACCATCAT 1 TCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTGCCAACTGATGAAACCATCAT * 204998 TGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACACCTCAGCCATGGAACGACACTT 66 TGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCCATGGAACGACACTT 205063 TTACC 131 TTACC 205068 TCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTGCCAACTGATGAAACCATCAT 1 TCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTGCCAACTGATGAAACCATCAT * * 205133 TGTCATCAGAACACCAACAACAGCCACTACTGCCATAACTACAACTGAGCCATGGAAC-AGCACT 66 TGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCCATGGAACGA-CACT 205197 TTTACC 130 TTTACC 205203 TCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTGCCAACTGATGAAACCATCAT 1 TCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTGCCAACTGATGAAACCATCAT * 205268 TGTCATCAGAACACCAACAACAGCCACTACTGCCATAACTACAACTCAGCCATGGAACGACACTT 66 TGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCCATGGAACGACACTT 205333 TTACC 131 TTACC 205338 TCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTGCCAACTGATGAAACCATCAT 1 TCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTGCCAACTGATGAAACCATCAT 205403 TGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCCATGGAACGACACTT 66 TGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCCATGGAACGACACTT 205468 TTACC 131 TTACC * * * 205473 TCTACATCCACTGAAATCACCACCGTCACCGGTACCACCGGTTTGCCAACTGATGAGACCATCAT 1 TCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTGCCAACTGATGAAACCATCAT 205538 TGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCCATGGAACGACACTT 66 TGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCCATGGAACGACACTT 205603 TTACC 131 TTACC * * * 205608 TCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGCGTT-CCAACTGACGAAACCGTCA 1 TCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGG-TTTGCCAACTGATGAAACCATCA * 205672 TTGTCATCAGAACTCCAAC 65 TTGTCATCAGAACACCAAC 205691 TAGTGAAGGT Statistics Matches: 1239, Mismatches: 53, Indels: 12 0.95 0.04 0.01 Matches are distributed among these distances: 134 3 0.00 135 1232 0.99 136 4 0.00 ACGTcount: A:0.32, C:0.33, G:0.14, T:0.21 Consensus pattern (135 bp): TCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTGCCAACTGATGAAACCATCAT TGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCCATGGAACGACACTT TTACC Found at i:205726 original size:135 final size:135 Alignment explanation

Indices: 204225--206230 Score: 1956 Period size: 135 Copynumber: 14.9 Consensus size: 135 204215 TACCACTACA * * * ** * * * 204225 ACTACAACGGAACCATGGACCGGTACTTTCACTTCTACATCTACTGAAATGACCACCGTCACCGG 1 ACTACAACTGAGCCATGGAACGACACTTTTACCTCTACATCCACTGAAATGACCACCGTCACCGG * * * * * 204290 TACCAACGGCGTT-CCAACTGACGAAACCGTCATTGTCATCAGAACTCCAACAACTGCTAGC-AC 66 TACCAACGGCTTTGCCAACTGACGAAACCATCATTGTCATCAGAACACCAACAACAGCCA-CTAC ** 204353 -CATCATA 130 TC--CAGC * * * * * * 204360 ACTACAACTGAGCCATGGAAC-AGCACTTTTACCTCTACTTCTACCGAATTGACCACAGTCACTG 1 ACTACAACTGAGCCATGGAACGA-CACTTTTACCTCTACATCCACTGAAATGACCACCGTCACCG * * * * * * 204424 GCACCAATGG-TGTACGAACTGACGAAACCATCATTGTAATCAGAACACCAACAACAGCCACTAC 65 GTACCAACGGCTTTGCCAACTGACGAAACCATCATTGTCATCAGAACACCAACAACAGCCACTAC ** 204488 TGCCATA 130 T-CCAGC * * * * * 204495 ACTACAACTGAGCCATGGAAC-AGCACTTTTACCTCTACTTCTACCGAATTGACCACAGTCACCG 1 ACTACAACTGAGCCATGGAACGA-CACTTTTACCTCTACATCCACTGAAATGACCACCGTCACCG * * * 204559 GTACCAATGG-TTTGCCAACTGATGAGACCATCATTGTCATCAGAACACCAACAACAGCCACTAC 65 GTACCAACGGCTTTGCCAACTGACGAAACCATCATTGTCATCAGAACACCAACAACAGCCACTAC 204623 TGCCATG- 130 T-CCA-GC * * * * * * 204630 ACTACAACTCAGCCATGGAACGACACTTTTACCTCTACTTCTACCGAATTGACCACAGTCACCGG 1 ACTACAACTGAGCCATGGAACGACACTTTTACCTCTACATCCACTGAAATGACCACCGTCACCGG * * * 204695 TACCAATGG-TTTGCCAACTGATGAGACCATCATTGTCATCAGAACACCAACAACAGCCACTACT 66 TACCAACGGCTTTGCCAACTGACGAAACCATCATTGTCATCAGAACACCAACAACAGCCACTACT 204759 GCCATG- 131 -CCA-GC * * * * * * 204765 ACTACAACTCAGCCATGGAACGACACTTTTACCTCTACTTCTACCGAATTGACCACAGTCACCGG 1 ACTACAACTGAGCCATGGAACGACACTTTTACCTCTACATCCACTGAAATGACCACCGTCACCGG * * * 204830 TACCAATGG-TTTGCCAACTGATGAGACCATCATTGTCATCAGAACACCAACAACAGCCACTACT 66 TACCAACGGCTTTGCCAACTGACGAAACCATCATTGTCATCAGAACACCAACAACAGCCACTACT 204894 GCCATG- 131 -CCA-GC * * 204900 ACTACAACTCAGCCATGGAACGACACTTTTACCTCTACATCCACTGAAATCACCACCGTCACCGG 1 ACTACAACTGAGCCATGGAACGACACTTTTACCTCTACATCCACTGAAATGACCACCGTCACCGG * * * 204965 TACCAATGG-TTTGCCAACTGATGAGACCATCATTGTCATCAGAACACCAACAACAGCCACTACT 66 TACCAACGGCTTTGCCAACTGACGAAACCATCATTGTCATCAGAACACCAACAACAGCCACTACT 205029 GCCATG- 131 -CCA-GC * * 205035 ACTACACCTCAGCCATGGAACGACACTTTTACCTCTACATCCACTGAAATGACCACCGTCACCGG 1 ACTACAACTGAGCCATGGAACGACACTTTTACCTCTACATCCACTGAAATGACCACCGTCACCGG * 205100 TACCAACGG-TTTGCCAACTGATGAAACCATCATTGTCATCAGAACACCAACAACAGCCACTACT 66 TACCAACGGCTTTGCCAACTGACGAAACCATCATTGTCATCAGAACACCAACAACAGCCACTACT ** 205164 GCCATA 131 -CCAGC 205170 ACTACAACTGAGCCATGGAAC-AGCACTTTTACCTCTACATCCACTGAAATGACCACCGTCACCG 1 ACTACAACTGAGCCATGGAACGA-CACTTTTACCTCTACATCCACTGAAATGACCACCGTCACCG * 205234 GTACCAACGG-TTTGCCAACTGATGAAACCATCATTGTCATCAGAACACCAACAACAGCCACTAC 65 GTACCAACGGCTTTGCCAACTGACGAAACCATCATTGTCATCAGAACACCAACAACAGCCACTAC ** 205298 TGCCATA 130 T-CCAGC * 205305 ACTACAACTCAGCCATGGAACGACACTTTTACCTCTACATCCACTGAAATGACCACCGTCACCGG 1 ACTACAACTGAGCCATGGAACGACACTTTTACCTCTACATCCACTGAAATGACCACCGTCACCGG * 205370 TACCAACGG-TTTGCCAACTGATGAAACCATCATTGTCATCAGAACACCAACAACAGCCACTACT 66 TACCAACGGCTTTGCCAACTGACGAAACCATCATTGTCATCAGAACACCAACAACAGCCACTACT 205434 GCCATG- 131 -CCA-GC * * 205440 ACTACAACTCAGCCATGGAACGACACTTTTACCTCTACATCCACTGAAATCACCACCGTCACCGG 1 ACTACAACTGAGCCATGGAACGACACTTTTACCTCTACATCCACTGAAATGACCACCGTCACCGG * * * 205505 TACCACCGG-TTTGCCAACTGATGAGACCATCATTGTCATCAGAACACCAACAACAGCCACTACT 66 TACCAACGGCTTTGCCAACTGACGAAACCATCATTGTCATCAGAACACCAACAACAGCCACTACT 205569 GCCATG- 131 -CCA-GC * 205575 ACTACAACTCAGCCATGGAACGACACTTTTACCTCTACATCCACTGAAATGACCACCGTCACCGG 1 ACTACAACTGAGCCATGGAACGACACTTTTACCTCTACATCCACTGAAATGACCACCGTCACCGG * * * ** 205640 TACCAACGGCGTT-CCAACTGACGAAACCGTCATTGTCATCAGAACTCCAACTAGTGA-AG-GTC 66 TACCAACGGCTTTGCCAACTGACGAAACCATCATTGTCATCAGAACACCAAC-A---ACAGCCAC * 205702 TAAT-CAGC 127 TACTCCAGC * * * ** * * 205710 ACCACCACTGAACCATGG-ACTGGTACTTTCACCTCTACATCCACTGAGATGACCACCGTCACCG 1 ACTACAACTGAGCCATGGAAC-GACACTTTTACCTCTACATCCACTGAAATGACCACCGTCACCG * *** * * * * ** 205774 GTACTAACGG-TCAACCAACTGACGAAACCGTGATTGTTATCAGAACTCCAAC--CAGTGA--AG 65 GTACCAACGGCTTTGCCAACTGACGAAACCATCATTGTCATCAGAACACCAACAACAGCCACTA- * *** 205834 GTTTGGTTAC 129 CTCCAG---C * * * ** * * * * * 205844 AACCACCACTGAACCATGG-ACTGGTACTTTTACTTCTACATCTACTGAAATGACCACCATTACT 1 -ACTACAACTGAGCCATGGAAC-GACACTTTTACCTCTACATCCACTGAAATGACCACCGTCACC * * * * * 205908 GGAACCAACGGCGTT-CCAACTGACGAAACCGTCATTGTCATCAGAACTCCAACCAGTGA-AG-G 64 GGTACCAACGGCTTTGCCAACTGACGAAACCATCATTGTCATCAGAACACCAA-CA---ACAGCC * * 205970 TCTAAT-CAGC 125 ACTACTCCAGC * * * ** * * * * * 205980 ACCACCACTGAACCATGG-ACTGGTACTTTTACTTCTACATCTACTGAAATGACCACCATTACTG 1 ACTACAACTGAGCCATGGAAC-GACACTTTTACCTCTACATCCACTGAAATGACCACCGTCACCG * * *** * * * * ** 206044 GAACCAATGG-TCAACCAACTGACGAAACCGTTATTGTTATCAGAACTCCAACTAGTGA-AG-GT 65 GTACCAACGGCTTTGCCAACTGACGAAACCATCATTGTCATCAGAACACCAAC-A---ACAGCCA * 206106 CTAAT-CAGC 126 CTACTCCAGC * * * ** * * * 206115 ACTACAACGGAACCATGGACCGGTACTTTCACTTCTACATCTACTGAAATGACGCA-CGTCACCG 1 ACTACAACTGAGCCATGGAACGACACTTTTACCTCTACATCCACTGAAATGAC-CACCGTCACCG * * * 206179 GTACCAACGGCGTT-CCAACTGACGAAACCGTCATTGTCATCAGAACTCCAAC 65 GTACCAACGGCTTTGCCAACTGACGAAACCATCATTGTCATCAGAACACCAAC 206231 CAGTGAAGGT Statistics Matches: 1713, Mismatches: 117, Indels: 82 0.90 0.06 0.04 Matches are distributed among these distances: 129 1 0.00 130 3 0.00 131 2 0.00 134 8 0.00 135 1675 0.98 136 10 0.01 137 5 0.00 138 2 0.00 139 3 0.00 140 3 0.00 141 1 0.00 ACGTcount: A:0.32, C:0.32, G:0.15, T:0.21 Consensus pattern (135 bp): ACTACAACTGAGCCATGGAACGACACTTTTACCTCTACATCCACTGAAATGACCACCGTCACCGG TACCAACGGCTTTGCCAACTGACGAAACCATCATTGTCATCAGAACACCAACAACAGCCACTACT CCAGC Found at i:205728 original size:270 final size:268 Alignment explanation

Indices: 204258--206500 Score: 2053 Period size: 270 Copynumber: 8.3 Consensus size: 268 204248 TACTTTCACT 204258 TCTACATCTACTGAAATGACCACCGTCACCGGTACCAACGGCGTTCCAACTGACGAAACCGTCAT 1 TCTACATCTACTGAAATGACCACCGTCACCGGTACCAACGGCGTTCCAACTGACGAAACCGTCAT * * ** 204323 TGTCATCAGAACTCCAACAACTGCTAGCAC-CATCATAACTACAACTGAGCCATGGAAC-AGCAC 66 TGTCATCAGAACTCCAAC-A-TG-AAGCACTAATCAGCACTACAACTGAGCCATGGAACGA-CAC * * * * * * * * * * 204386 TTTTACCTCTACTTCTACCGAATTGACCACAGTCACTGGCACCAATGGTGTACGAACTGACGAAA 127 TTTTACCTCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTACCAACTGACGAAA * * * 204451 CCATCATTGTAATCAGAACACCAACAACAGCCACTACTGCCATAACTACAACTGAGCCATGGAAC 192 CCATCATTGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCCATGGAAC 204516 -AGCACTTTTACC 257 GA-CACTTTTACC * * * * * * * * * 204528 TCTACTTCTACCGAATTGACCACAGTCACCGGTACCAATGG-TTTGCCAACTGATGAGACCATCA 1 TCTACATCTACTGAAATGACCACCGTCACCGGTACCAACGGCGTT-CCAACTGACGAAACCGTCA * * * 204592 TTGTCATCAGAACACCAACA--ACAGCCACTACTGCCATG-ACTACAACTCAGCCATGGAACGAC 65 TTGTCATCAGAACTCCAACATGA-AG-CACTAAT--CA-GCACTACAACTGAGCCATGGAACGAC * * * * * * * * 204654 ACTTTTACCTCTACTTCTACCGAATTGACCACAGTCACCGGTACCAATGGTTTGCCAACTGATGA 125 ACTTTTACCTCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTACCAACTGACGA * 204719 GACCATCATTGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCCATGGA 190 AACCATCATTGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCCATGGA 204784 ACGACACTTTTACC 255 ACGACACTTTTACC * * * * * * * * * 204798 TCTACTTCTACCGAATTGACCACAGTCACCGGTACCAATGG-TTTGCCAACTGATGAGACCATCA 1 TCTACATCTACTGAAATGACCACCGTCACCGGTACCAACGGCGTT-CCAACTGACGAAACCGTCA * * * 204862 TTGTCATCAGAACACCAACA--ACAGCCACTACTGCCATG-ACTACAACTCAGCCATGGAACGAC 65 TTGTCATCAGAACTCCAACATGA-AG-CACTAAT--CA-GCACTACAACTGAGCCATGGAACGAC * * * * 204924 ACTTTTACCTCTACATCCACTGAAATCACCACCGTCACCGGTACCAATGGTTTGCCAACTGATGA 125 ACTTTTACCTCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTACCAACTGACGA * * 204989 GACCATCATTGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACACCTCAGCCATGGA 190 AACCATCATTGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCCATGGA 205054 ACGACACTTTTACC 255 ACGACACTTTTACC * * * * 205068 TCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGG-TTTGCCAACTGATGAAACCATCA 1 TCTACATCTACTGAAATGACCACCGTCACCGGTACCAACGGCGTT-CCAACTGACGAAACCGTCA * * ** 205132 TTGTCATCAGAACACCAACA--ACAGCCACTACTGCCATAACTACAACTGAGCCATGGAAC-AGC 65 TTGTCATCAGAACTCCAACATGA-AG-CACTAAT--CAGCACTACAACTGAGCCATGGAACGA-C * * 205194 ACTTTTACCTCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTGCCAACTGATGA 125 ACTTTTACCTCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTACCAACTGACGA * 205259 AACCATCATTGTCATCAGAACACCAACAACAGCCACTACTGCCATAACTACAACTCAGCCATGGA 190 AACCATCATTGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCCATGGA 205324 ACGACACTTTTACC 255 ACGACACTTTTACC * * * * 205338 TCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGG-TTTGCCAACTGATGAAACCATCA 1 TCTACATCTACTGAAATGACCACCGTCACCGGTACCAACGGCGTT-CCAACTGACGAAACCGTCA * * * 205402 TTGTCATCAGAACACCAACA--ACAGCCACTACTGCCATG-ACTACAACTCAGCCATGGAACGAC 65 TTGTCATCAGAACTCCAACATGA-AG-CACTAAT--CA-GCACTACAACTGAGCCATGGAACGAC * * * * 205464 ACTTTTACCTCTACATCCACTGAAATCACCACCGTCACCGGTACCACCGGTTTGCCAACTGATGA 125 ACTTTTACCTCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTACCAACTGACGA * 205529 GACCATCATTGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCCATGGA 190 AACCATCATTGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCCATGGA 205594 ACGACACTTTTACC 255 ACGACACTTTTACC * 205608 TCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGCGTTCCAACTGACGAAACCGTCAT 1 TCTACATCTACTGAAATGACCACCGTCACCGGTACCAACGGCGTTCCAACTGACGAAACCGTCAT ** * * * ** 205673 TGTCATCAGAACTCCAACTAGTGAAGGTCTAATCAGCACCACCACTGAACCATGG-ACTGGTACT 66 TGTCATCAGAACTCCAAC-A-TGAAGCACTAATCAGCACTACAACTGAGCCATGGAAC-GACACT * * * ** 205737 TTCACCTCTACATCCACTGAGATGACCACCGTCACCGGTACTAACGGTCAACCAACTGACGAAAC 128 TTTACCTCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTACCAACTGACGAAAC * * * * ** * * ** ** * * * * 205802 CGTGATTGTTATCAGAACTCCAAC--CAGTGAAGGT-TTGGTTACAACCACCACTGAACCATGG- 193 CATCATTGTCATCAGAACACCAACAACAG-CCA-CTACT-GCCATGACTACAACTCAGCCATGGA ** * 205863 ACTGGTACTTTTACT 255 AC-GACACTTTTACC * * * * 205878 TCTACATCTACTGAAATGACCACCATTACTGGAACCAACGGCGTTCCAACTGACGAAACCGTCAT 1 TCTACATCTACTGAAATGACCACCGTCACCGGTACCAACGGCGTTCCAACTGACGAAACCGTCAT ** * * * ** 205943 TGTCATCAGAACTCCAACCAGTGAAGGTCTAATCAGCACCACCACTGAACCATGG-ACTGGTACT 66 TGTCATCAGAACTCCAA-CA-TGAAGCACTAATCAGCACTACAACTGAGCCATGGAAC-GACACT * * * * * * * ** 206007 TTTACTTCTACATCTACTGAAATGACCACCATTACTGGAACCAATGGTCAACCAACTGACGAAAC 128 TTTACCTCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTACCAACTGACGAAAC * * * * ** * ** * 206072 CGTTATTGTTATCAGAACTCCAACTAGTGA-AG-GTCTAAT--CA-GCACTACAACGGAACCATG 193 CATCATTGTCATCAGAACACCAAC-A---ACAGCCACTACTGCCATG-ACTACAACTCAGCCATG * ** * * 206132 GACCGGTACTTTCACT 253 GAACGACACTTTTACC 206148 TCTACATCTACTGAAATGACGCA-CGTCACCGGTACCAACGGCGTTCCAACTGACGAAACCGTCA 1 TCTACATCTACTGAAATGAC-CACCGTCACCGGTACCAACGGCGTTCCAACTGACGAAACCGTCA ** * * * * 206212 TTGTCATCAGAACTCCAACCAGTGAAGGTCTAATCAGCACCACCACTGAACCATGG-ACTGGCAC 65 TTGTCATCAGAACTCCAA-CA-TGAAGCACTAATCAGCACTACAACTGAGCCATGGAAC-GACAC * * * * ** * * * * ** 206276 TTTCACTTCGACTTCCACTGAGGTTACCACCATCACTGGAACCAACGGTCAACCAACTGACGAAA 127 TTTTACCTCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTACCAACTGACGAAA ** * * * ** * * * * * 206341 CTGTGATTGTTATCAGAACTCCAACCAGTGA-AG-GTCTAAT--CA-GCACCACCACTGAACCAT 192 CCATCATTGTCATCAGAACACCAA-CA---ACAGCCACTACTGCCATG-ACTACAACTCAGCCAT ** * * 206401 GG-ACTGGTACTTTCACT 252 GGAAC-GACACTTTTACC * ** * 206418 TCTACATCTACTGAAATGACCACCGTCACCGGTACTAACGGTC-AACCAACTGACGAAACCGTGA 1 TCTACATCTACTGAAATGACCACCGTCACCGGTACCAACGG-CGTTCCAACTGACGAAACCGTCA * 206482 TTGTTATCAGAACTCCAAC 65 TTGTCATCAGAACTCCAAC 206501 CAGTGAAGGT Statistics Matches: 1788, Mismatches: 146, Indels: 79 0.89 0.07 0.04 Matches are distributed among these distances: 266 2 0.00 267 3 0.00 268 4 0.00 269 15 0.01 270 1741 0.97 271 12 0.01 272 5 0.00 273 3 0.00 274 1 0.00 275 2 0.00 ACGTcount: A:0.32, C:0.32, G:0.15, T:0.21 Consensus pattern (268 bp): TCTACATCTACTGAAATGACCACCGTCACCGGTACCAACGGCGTTCCAACTGACGAAACCGTCAT TGTCATCAGAACTCCAACATGAAGCACTAATCAGCACTACAACTGAGCCATGGAACGACACTTTT ACCTCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTACCAACTGACGAAACCAT CATTGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCCATGGAACGACA CTTTTACC Found at i:205728 original size:405 final size:403 Alignment explanation

Indices: 204258--206230 Score: 2164 Period size: 405 Copynumber: 4.9 Consensus size: 403 204248 TACTTTCACT * * * 204258 TCTACATCTACTGAAATGACCACCGTCACCGGTACCAACGGCGTT-CCAACTGACGAAACCGTCA 1 TCTACATCTACTGAAATGACCACCGTCACCGGTACCAACGG-TTTGCCAACTGATGAAACCATCA * * * *** * 204322 TTGTCATCAGAACTCCAACAACTGCTAGC-ACCATCATAACTACAACTGAGCCATGGAAC-AGCA 65 TTGTCATCAGAACACCAACAACAGCCA-CTACTGCCATGACTACAACTGAGCCATGGAACGA-CA * * * * * * * * 204385 CTTTTACCTCTACTTCTACCGAATTGACCACAGTCACTGGCACCAATGGTGTACGAACTGACGAA 128 CTTTTACCTCTACATCTACTGAAATGACCACCGTCACCGGTACCAATGG-GTTCCAACTGACGAA * * 204450 ACCATCATTGTAATCAGAACACCAACAACAGCCACTACTGCCATAACTACAACTGAGCCATGGAA 192 ACCATCATTGTCATCAGAACACCAACAACAGCCACTACT-CCAGAACTACAACTGAGCCATGGAA * * * * * * 204515 C-AGCACTTTTACCTCTACTTCTACCGAATTGACCACAGTCACCGGTACCAATGGTTTGCCAACT 256 CGA-CACTTTTACCTCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTGCCAACT * 204579 GATGAGACCATCATTGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCC 320 GATGAAACCATCATTGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCC 204644 ATGGAACGACACTTTTACC 385 ATGGAACGACACTTTTACC * * * * * * 204663 TCTACTTCTACCGAATTGACCACAGTCACCGGTACCAATGGTTTGCCAACTGATGAGACCATCAT 1 TCTACATCTACTGAAATGACCACCGTCACCGGTACCAACGGTTTGCCAACTGATGAAACCATCAT * 204728 TGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCCATGGAACGACACTT 66 TGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTGAGCCATGGAACGACACTT * * * * * * * 204793 TTACCTCTACTTCTACCGAATTGACCACAGTCACCGGTACCAATGGTTTGCCAACTGATGAGACC 131 TTACCTCTACATCTACTGAAATGACCACCGTCACCGGTACCAATGGGTT-CCAACTGACGAAACC * 204858 ATCATTGTCATCAGAACACCAACAACAGCCACTACTGCCATG-ACTACAACTCAGCCATGGAACG 195 ATCATTGTCATCAGAACACCAACAACAGCCACTACT-CCA-GAACTACAACTGAGCCATGGAACG * * 204922 ACACTTTTACCTCTACATCCACTGAAATCACCACCGTCACCGGTACCAATGGTTTGCCAACTGAT 258 ACACTTTTACCTCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTGCCAACTGAT * * 204987 GAGACCATCATTGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACACCTCAGCCATG 323 GAAACCATCATTGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCCATG 205052 GAACGACACTTTTACC 388 GAACGACACTTTTACC * 205068 TCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTGCCAACTGATGAAACCATCAT 1 TCTACATCTACTGAAATGACCACCGTCACCGGTACCAACGGTTTGCCAACTGATGAAACCATCAT * 205133 TGTCATCAGAACACCAACAACAGCCACTACTGCCATAACTACAACTGAGCCATGGAAC-AGCACT 66 TGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTGAGCCATGGAACGA-CACT * * * * 205197 TTTACCTCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTGCCAACTGATGAAAC 130 TTTACCTCTACATCTACTGAAATGACCACCGTCACCGGTACCAATGGGTT-CCAACTGACGAAAC * * 205262 CATCATTGTCATCAGAACACCAACAACAGCCACTACTGCCATAACTACAACTCAGCCATGGAACG 194 CATCATTGTCATCAGAACACCAACAACAGCCACTACT-CCAGAACTACAACTGAGCCATGGAACG 205327 ACACTTTTACCTCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTGCCAACTGAT 258 ACACTTTTACCTCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTGCCAACTGAT 205392 GAAACCATCATTGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCCATG 323 GAAACCATCATTGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCCATG 205457 GAACGACACTTTTACC 388 GAACGACACTTTTACC * * * * 205473 TCTACATCCACTGAAATCACCACCGTCACCGGTACCACCGGTTTGCCAACTGATGAGACCATCAT 1 TCTACATCTACTGAAATGACCACCGTCACCGGTACCAACGGTTTGCCAACTGATGAAACCATCAT * 205538 TGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCCATGGAACGACACTT 66 TGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTGAGCCATGGAACGACACTT * * 205603 TTACCTCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGCGTTCCAACTGACGAAACC 131 TTACCTCTACATCTACTGAAATGACCACCGTCACCGGTACCAATGG-GTTCCAACTGACGAAACC * * ** * * * * * 205668 GTCATTGTCATCAGAACTCCAACTAGTGA-AG-GTCTAAT-CAGCACCACCACTGAACCATGG-A 195 ATCATTGTCATCAGAACACCAAC-A---ACAGCCACTACTCCAGAACTACAACTGAGCCATGGAA ** * * * *** 205729 CTGGTACTTTCACCTCTACATCCACTGAGATGACCACCGTCACCGGTACTAACGGTCAACCAACT 256 C-GACACTTTTACCTCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTGCCAACT * * * * * ** * * ** ** * * * 205794 GACGAAACCGTGATTGTTATCAGAACTCCAAC--CAGTGAAGGT-TTGGTTACAACCACCACTGA 320 GATGAAACCATCATTGTCATCAGAACACCAACAACAG-CCA-CTACT-GCCATGACTACAACTCA * ** * 205856 ACCATGG-ACTGGTACTTTTACT 382 GCCATGGAAC-GACACTTTTACC * * * * * * * 205878 TCTACATCTACTGAAATGACCACCATTACTGGAACCAACGGCGTT-CCAACTGACGAAACCGTCA 1 TCTACATCTACTGAAATGACCACCGTCACCGGTACCAACGG-TTTGCCAACTGATGAAACCATCA * ** * * * * 205942 TTGTCATCAGAACTCCAACCAGTGA-AG-GTCTAAT--CA-GCACCACCACTGAACCATGG-ACT 65 TTGTCATCAGAACACCAA-CA---ACAGCCACTACTGCCATG-ACTACAACTGAGCCATGGAAC- ** * * * * * * 206001 GGTACTTTTACTTCTACATCTACTGAAATGACCACCATTACTGGAACCAAT-GGTCAACCAACTG 124 GACACTTTTACCTCTACATCTACTGAAATGACCACCGTCACCGGTACCAATGGGT--TCCAACTG * * * * ** * * * * 206065 ACGAAACCGTTATTGTTATCAGAACTCCAACTAGTGA-AG-GTCTAAT-CAGCACTACAACGGAA 187 ACGAAACCATCATTGTCATCAGAACACCAAC-A---ACAGCCACTACTCCAGAACTACAACTGAG * ** * * * * 206127 CCATGGACCGGTACTTTCACTTCTACATCTACTGAAATGACGCA-CGTCACCGGTACCAACGGCG 248 CCATGGAACGACACTTTTACCTCTACATCCACTGAAATGAC-CACCGTCACCGGTACCAACGG-T * * * 206191 TT-CCAACTGACGAAACCGTCATTGTCATCAGAACTCCAAC 311 TTGCCAACTGATGAAACCATCATTGTCATCAGAACACCAAC 206231 CAGTGAAGGT Statistics Matches: 1392, Mismatches: 145, Indels: 62 0.87 0.09 0.04 Matches are distributed among these distances: 403 5 0.00 404 15 0.01 405 1345 0.97 406 13 0.01 407 8 0.01 408 4 0.00 409 2 0.00 ACGTcount: A:0.32, C:0.32, G:0.15, T:0.21 Consensus pattern (403 bp): TCTACATCTACTGAAATGACCACCGTCACCGGTACCAACGGTTTGCCAACTGATGAAACCATCAT TGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTGAGCCATGGAACGACACTT TTACCTCTACATCTACTGAAATGACCACCGTCACCGGTACCAATGGGTTCCAACTGACGAAACCA TCATTGTCATCAGAACACCAACAACAGCCACTACTCCAGAACTACAACTGAGCCATGGAACGACA CTTTTACCTCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGTTTGCCAACTGATGAA ACCATCATTGTCATCAGAACACCAACAACAGCCACTACTGCCATGACTACAACTCAGCCATGGAA CGACACTTTTACC Found at i:206263 original size:135 final size:135 Alignment explanation

Indices: 205608--206635 Score: 1305 Period size: 135 Copynumber: 7.6 Consensus size: 135 205598 CACTTTTACC * ** 205608 TCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGG-CGTTCCAACTGACGAAACCGTCA 1 TCTACATCCACTGAAATGACCACCGTCACCGGAACCAACGGTC-AACCAACTGACGAAACCGTCA * * 205672 TTGTCATCAGAACTCCAACTAGTGAAGGTCTAATCAGCACCACCACTGAACCATGGACTGGTACT 65 TTGTTATCAGAACTCCAACCAGTGAAGGTCTAATCAGCACCACCACTGAACCATGGACTGGTACT * 205737 TTCACC 130 TTCACT * * * * 205743 TCTACATCCACTGAGATGACCACCGTCACCGGTACTAACGGTCAACCAACTGACGAAACCGTGAT 1 TCTACATCCACTGAAATGACCACCGTCACCGGAACCAACGGTCAACCAACTGACGAAACCGTCAT * ** * 205808 TGTTATCAGAACTCCAACCAGTGAAGGTTTGGTTA-CAACCACCACTGAACCATGGACTGGTACT 66 TGTTATCAGAACTCCAACCAGTGAAGGTCTAATCAGC-ACCACCACTGAACCATGGACTGGTACT * 205872 TTTACT 130 TTCACT * * * * ** 205878 TCTACATCTACTGAAATGACCACCATTACTGGAACCAACGG-CGTTCCAACTGACGAAACCGTCA 1 TCTACATCCACTGAAATGACCACCGTCACCGGAACCAACGGTC-AACCAACTGACGAAACCGTCA * 205942 TTGTCATCAGAACTCCAACCAGTGAAGGTCTAATCAGCACCACCACTGAACCATGGACTGGTACT 65 TTGTTATCAGAACTCCAACCAGTGAAGGTCTAATCAGCACCACCACTGAACCATGGACTGGTACT * 206007 TTTACT 130 TTCACT * * * * * * 206013 TCTACATCTACTGAAATGACCACCATTACTGGAACCAATGGTCAACCAACTGACGAAACCGTTAT 1 TCTACATCCACTGAAATGACCACCGTCACCGGAACCAACGGTCAACCAACTGACGAAACCGTCAT * * * * * 206078 TGTTATCAGAACTCCAACTAGTGAAGGTCTAATCAGCACTACAACGGAACCATGGACCGGTACTT 66 TGTTATCAGAACTCCAACCAGTGAAGGTCTAATCAGCACCACCACTGAACCATGGACTGGTACTT 206143 TCACT 131 TCACT * * ** 206148 TCTACATCTACTGAAATGACGCA-CGTCACCGGTACCAACGG-CGTTCCAACTGACGAAACCGTC 1 TCTACATCCACTGAAATGAC-CACCGTCACCGGAACCAACGGTC-AACCAACTGACGAAACCGTC * * 206211 ATTGTCATCAGAACTCCAACCAGTGAAGGTCTAATCAGCACCACCACTGAACCATGGACTGGCAC 64 ATTGTTATCAGAACTCCAACCAGTGAAGGTCTAATCAGCACCACCACTGAACCATGGACTGGTAC 206276 TTTCACT 129 TTTCACT * * ** * * * * * 206283 TCGACTTCCACTGAGGTTACCACCATCACTGGAACCAACGGTCAACCAACTGACGAAACTGTGAT 1 TCTACATCCACTGAAATGACCACCGTCACCGGAACCAACGGTCAACCAACTGACGAAACCGTCAT 206348 TGTTATCAGAACTCCAACCAGTGAAGGTCTAATCAGCACCACCACTGAACCATGGACTGGTACTT 66 TGTTATCAGAACTCCAACCAGTGAAGGTCTAATCAGCACCACCACTGAACCATGGACTGGTACTT 206413 TCACT 131 TCACT * * * * 206418 TCTACATCTACTGAAATGACCACCGTCACCGGTACTAACGGTCAACCAACTGACGAAACCGTGAT 1 TCTACATCCACTGAAATGACCACCGTCACCGGAACCAACGGTCAACCAACTGACGAAACCGTCAT * ** * 206483 TGTTATCAGAACTCCAACCAGTGAAGGTTTGGTTA-CAACCACCACTGAACCATGGACTGGTACT 66 TGTTATCAGAACTCCAACCAGTGAAGGTCTAATCAGC-ACCACCACTGAACCATGGACTGGTACT * 206547 TTTACT 130 TTCACT * * * * * * * ** * * 206553 TCGACTTCCACTGAAATGTCTACTGTCACTGGAACCAATGG-CTTGCCAACTGATGAAACTGTCA 1 TCTACATCCACTGAAATGACCACCGTCACCGGAACCAACGGTC-AACCAACTGACGAAACCGTCA * * 206617 TTGTTGTCAAAACTCCAAC 65 TTGTTATCAGAACTCCAAC 206636 TACTGCCATC Statistics Matches: 780, Mismatches: 102, Indels: 22 0.86 0.11 0.02 Matches are distributed among these distances: 134 7 0.01 135 767 0.98 136 6 0.01 ACGTcount: A:0.30, C:0.29, G:0.17, T:0.23 Consensus pattern (135 bp): TCTACATCCACTGAAATGACCACCGTCACCGGAACCAACGGTCAACCAACTGACGAAACCGTCAT TGTTATCAGAACTCCAACCAGTGAAGGTCTAATCAGCACCACCACTGAACCATGGACTGGTACTT TCACT Found at i:206604 original size:270 final size:270 Alignment explanation

Indices: 205608--206635 Score: 1454 Period size: 270 Copynumber: 3.8 Consensus size: 270 205598 CACTTTTACC * 205608 TCTACATCCACTGAAATGACCACCGTCACCGGTACCAACGGCGTTCCAACTGACGAAACCGTCAT 1 TCTACATCTACTGAAATGACCACCGTCACCGGTACCAACGGCGTTCCAACTGACGAAACCGTCAT * 205673 TGTCATCAGAACTCCAACTAGTGAAGGTCTAATCAGCACCACCACTGAACCATGGACTGGTACTT 66 TGTCATCAGAACTCCAACCAGTGAAGGTCTAATCAGCACCACCACTGAACCATGGACTGGTACTT * * * * * * * 205738 TCACCTCTACATCCACTGAGATGACCACCGTCACCGGTACTAACGGTCAACCAACTGACGAAACC 131 TCACTTCGACATCCACTGAAATGACCACCATCACTGGAACCAACGGTCAACCAACTGACGAAACC * ** * 205803 GTGATTGTTATCAGAACTCCAACCAGTGAAGGTTTGGTTA-CAACCACCACTGAACCATGGACTG 196 GTGATTGTTATCAGAACTCCAACCAGTGAAGGTCTAATCAGC-ACCACCACTGAACCATGGACTG * 205867 GTACTTTTACT 260 GTACTTTCACT * * * * 205878 TCTACATCTACTGAAATGACCACCATTACTGGAACCAACGGCGTTCCAACTGACGAAACCGTCAT 1 TCTACATCTACTGAAATGACCACCGTCACCGGTACCAACGGCGTTCCAACTGACGAAACCGTCAT 205943 TGTCATCAGAACTCCAACCAGTGAAGGTCTAATCAGCACCACCACTGAACCATGGACTGGTACTT 66 TGTCATCAGAACTCCAACCAGTGAAGGTCTAATCAGCACCACCACTGAACCATGGACTGGTACTT * * * * * 206008 TTACTTCTACATCTACTGAAATGACCACCATTACTGGAACCAATGGTCAACCAACTGACGAAACC 131 TCACTTCGACATCCACTGAAATGACCACCATCACTGGAACCAACGGTCAACCAACTGACGAAACC * * * * * * 206073 GTTATTGTTATCAGAACTCCAACTAGTGAAGGTCTAATCAGCACTACAACGGAACCATGGACCGG 196 GTGATTGTTATCAGAACTCCAACCAGTGAAGGTCTAATCAGCACCACCACTGAACCATGGACTGG 206138 TACTTTCACT 261 TACTTTCACT 206148 TCTACATCTACTGAAATGACGCA-CGTCACCGGTACCAACGGCGTTCCAACTGACGAAACCGTCA 1 TCTACATCTACTGAAATGAC-CACCGTCACCGGTACCAACGGCGTTCCAACTGACGAAACCGTCA * 206212 TTGTCATCAGAACTCCAACCAGTGAAGGTCTAATCAGCACCACCACTGAACCATGGACTGGCACT 65 TTGTCATCAGAACTCCAACCAGTGAAGGTCTAATCAGCACCACCACTGAACCATGGACTGGTACT * ** * 206277 TTCACTTCGACTTCCACTGAGGTTACCACCATCACTGGAACCAACGGTCAACCAACTGACGAAAC 130 TTCACTTCGACATCCACTGAAATGACCACCATCACTGGAACCAACGGTCAACCAACTGACGAAAC * 206342 TGTGATTGTTATCAGAACTCCAACCAGTGAAGGTCTAATCAGCACCACCACTGAACCATGGACTG 195 CGTGATTGTTATCAGAACTCCAACCAGTGAAGGTCTAATCAGCACCACCACTGAACCATGGACTG 206407 GTACTTTCACT 260 GTACTTTCACT * ** * 206418 TCTACATCTACTGAAATGACCACCGTCACCGGTACTAACGGTC-AACCAACTGACGAAACCGTGA 1 TCTACATCTACTGAAATGACCACCGTCACCGGTACCAACGG-CGTTCCAACTGACGAAACCGTCA * * ** * 206482 TTGTTATCAGAACTCCAACCAGTGAAGGTTTGGTTA-CAACCACCACTGAACCATGGACTGGTAC 65 TTGTCATCAGAACTCCAACCAGTGAAGGTCTAATCAGC-ACCACCACTGAACCATGGACTGGTAC * * * * ** * ** * 206546 TTTTACTTCGACTTCCACTGAAATGTCTACTGTCACTGGAACCAATGG-CTTGCCAACTGATGAA 129 TTTCACTTCGACATCCACTGAAATGACCACCATCACTGGAACCAACGGTC-AACCAACTGACGAA * * * * 206610 ACTGTCATTGTTGTCAAAACTCCAAC 193 ACCGTGATTGTTATCAGAACTCCAAC 206636 TACTGCCATC Statistics Matches: 679, Mismatches: 73, Indels: 12 0.89 0.10 0.02 Matches are distributed among these distances: 269 4 0.01 270 671 0.99 271 4 0.01 ACGTcount: A:0.30, C:0.29, G:0.17, T:0.23 Consensus pattern (270 bp): TCTACATCTACTGAAATGACCACCGTCACCGGTACCAACGGCGTTCCAACTGACGAAACCGTCAT TGTCATCAGAACTCCAACCAGTGAAGGTCTAATCAGCACCACCACTGAACCATGGACTGGTACTT TCACTTCGACATCCACTGAAATGACCACCATCACTGGAACCAACGGTCAACCAACTGACGAAACC GTGATTGTTATCAGAACTCCAACCAGTGAAGGTCTAATCAGCACCACCACTGAACCATGGACTGG TACTTTCACT Found at i:206768 original size:15 final size:15 Alignment explanation

Indices: 206748--206830 Score: 98 Period size: 15 Copynumber: 5.5 Consensus size: 15 206738 AACTTCTGTG * 206748 ATTTCTTCCTCAGTA 1 ATTTCTTCCTCAGTC 206763 ATTTCTTCCTCAGTC 1 ATTTCTTCCTCAGTC * * 206778 ACTTCTT-CTCTATTC 1 ATTTCTTCCTC-AGTC * 206793 ACTTCTT-CTCCAGTC 1 ATTTCTTCCT-CAGTC 206808 ATTTCTTCCTCAGTC 1 ATTTCTTCCTCAGTC 206823 ATTTCTTC 1 ATTTCTTC 206831 TTCTACAACA Statistics Matches: 60, Mismatches: 5, Indels: 6 0.85 0.07 0.08 Matches are distributed among these distances: 14 3 0.05 15 54 0.90 16 3 0.05 ACGTcount: A:0.14, C:0.33, G:0.05, T:0.48 Consensus pattern (15 bp): ATTTCTTCCTCAGTC Found at i:207256 original size:21 final size:21 Alignment explanation

Indices: 207227--207288 Score: 79 Period size: 21 Copynumber: 3.0 Consensus size: 21 207217 TTTCTACTAC 207227 AGAGACAACAAAGCAAACCAA 1 AGAGACAACAAAGCAAACCAA * * * 207248 AGGGACAACAGAGCAAACCAC 1 AGAGACAACAAAGCAAACCAA * * 207269 AGAAACAACAAAACAAACCA 1 AGAGACAACAAAGCAAACCA 207289 CGGTAGTTAC Statistics Matches: 34, Mismatches: 7, Indels: 0 0.83 0.17 0.00 Matches are distributed among these distances: 21 34 1.00 ACGTcount: A:0.60, C:0.26, G:0.15, T:0.00 Consensus pattern (21 bp): AGAGACAACAAAGCAAACCAA Found at i:207664 original size:27 final size:27 Alignment explanation

Indices: 207614--207702 Score: 124 Period size: 27 Copynumber: 3.3 Consensus size: 27 207604 GTGCTACCGG * * * 207614 TGAGACAACAACCAATACTTTAGCTGC 1 TGAGACGACTACCAATACTGTAGCTGC * 207641 TGAAACGACTACCAATACTGTAGCTGC 1 TGAGACGACTACCAATACTGTAGCTGC * * 207668 TGAGACGATTACCAATACTGGAGCTGC 1 TGAGACGACTACCAATACTGTAGCTGC 207695 TGAGACGA 1 TGAGACGA 207703 AAACAGTAGT Statistics Matches: 55, Mismatches: 7, Indels: 0 0.89 0.11 0.00 Matches are distributed among these distances: 27 55 1.00 ACGTcount: A:0.34, C:0.24, G:0.21, T:0.21 Consensus pattern (27 bp): TGAGACGACTACCAATACTGTAGCTGC Found at i:219206 original size:15 final size:15 Alignment explanation

Indices: 219186--219220 Score: 52 Period size: 15 Copynumber: 2.3 Consensus size: 15 219176 TTCTGTAGTT 219186 TCTTCCTCAGTCATG 1 TCTTCCTCAGTCATG * * 219201 TCTTCCTCGGTCATT 1 TCTTCCTCAGTCATG 219216 TCTTC 1 TCTTC 219221 TTCTGCAACG Statistics Matches: 18, Mismatches: 2, Indels: 0 0.90 0.10 0.00 Matches are distributed among these distances: 15 18 1.00 ACGTcount: A:0.09, C:0.34, G:0.11, T:0.46 Consensus pattern (15 bp): TCTTCCTCAGTCATG Found at i:223126 original size:1 final size:1 Alignment explanation

Indices: 223120--223155 Score: 72 Period size: 1 Copynumber: 36.0 Consensus size: 1 223110 CACATTCTTC 223120 TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 1 TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 223156 CATTTACTTT Statistics Matches: 35, Mismatches: 0, Indels: 0 1.00 0.00 0.00 Matches are distributed among these distances: 1 35 1.00 ACGTcount: A:0.00, C:0.00, G:0.00, T:1.00 Consensus pattern (1 bp): T Found at i:229772 original size:15 final size:15 Alignment explanation

Indices: 229752--229807 Score: 76 Period size: 15 Copynumber: 3.7 Consensus size: 15 229742 AGATGATGTA * * 229752 TTGTTTACGTTATAT 1 TTGTTTACATTAGAT * * 229767 TTGTTTAAATTGGAT 1 TTGTTTACATTAGAT 229782 TTGTTTACATTAGAT 1 TTGTTTACATTAGAT 229797 TTGTTTACATT 1 TTGTTTACATT 229808 TCAATATATC Statistics Matches: 35, Mismatches: 6, Indels: 0 0.85 0.15 0.00 Matches are distributed among these distances: 15 35 1.00 ACGTcount: A:0.23, C:0.05, G:0.14, T:0.57 Consensus pattern (15 bp): TTGTTTACATTAGAT Found at i:229967 original size:11 final size:11 Alignment explanation

Indices: 229947--229977 Score: 55 Period size: 11 Copynumber: 2.9 Consensus size: 11 229937 TTGGGGTGTG 229947 GTGA-TGGATA 1 GTGAGTGGATA 229957 GTGAGTGGATA 1 GTGAGTGGATA 229968 GTGAGTGGAT 1 GTGAGTGGAT 229978 GGATGGTGGA Statistics Matches: 20, Mismatches: 0, Indels: 1 0.95 0.00 0.05 Matches are distributed among these distances: 10 4 0.20 11 16 0.80 ACGTcount: A:0.26, C:0.00, G:0.45, T:0.29 Consensus pattern (11 bp): GTGAGTGGATA Found at i:230129 original size:6 final size:6 Alignment explanation

Indices: 230109--230205 Score: 146 Period size: 6 Copynumber: 16.2 Consensus size: 6 230099 GTTAGTATTA 230109 GGGTGT GGTGTGT GGGTGT -GGTGT GGGTGT GGGTGT GGGTGT GGGTGT 1 GGGTGT GG-GTGT GGGTGT GGGTGT GGGTGT GGGTGT GGGTGT GGGTGT 230157 GGGTGT GGGTGT -GGTGT GGTGTGT GGGTGT -GGTGT GGGTGT GGTGTGT 1 GGGTGT GGGTGT GGGTGT GG-GTGT GGGTGT GGGTGT GGGTGT GG-GTGT 230205 G 1 G 230206 TGGG Statistics Matches: 85, Mismatches: 0, Indels: 11 0.89 0.00 0.11 Matches are distributed among these distances: 5 15 0.18 6 53 0.62 7 17 0.20 ACGTcount: A:0.00, C:0.00, G:0.64, T:0.36 Consensus pattern (6 bp): GGGTGT Found at i:230206 original size:2 final size:2 Alignment explanation

Indices: 230111--230207 Score: 71 Period size: 2 Copynumber: 51.5 Consensus size: 2 230101 TAGTATTAGG * * * * 230111 GT GT G- GT GT GT GG GT GT G- GT GT GG GT GT GG GT GT GG GT GT 1 GT GT GT GT GT GT GT GT GT GT GT GT GT GT GT GT GT GT GT GT GT * * * * 230151 GG GT GT GG GT GT GG GT GT G- GT GT G- GT GT GT GG GT GT G- GT 1 GT GT GT GT GT GT GT GT GT GT GT GT GT GT GT GT GT GT GT GT GT * 230190 GT GG GT GT G- GT GT GT GT G 1 GT GT GT GT GT GT GT GT GT G 230208 GG Statistics Matches: 71, Mismatches: 18, Indels: 12 0.70 0.18 0.12 Matches are distributed among these distances: 1 6 0.08 2 65 0.92 ACGTcount: A:0.00, C:0.00, G:0.63, T:0.37 Consensus pattern (2 bp): GT Done.